Business Planning-The Twist Kettle Assignment Example | Topics and Well Written Essays - 1750 words

Business Planning-The Twist Kettle - Assignment Example Twist Kettle was basically designed to address these problems and introduce in the mainstream market a more improved kettle. The product is designed along the lines of eco products; preventing energy waste while at the same time is distinguished by the ease of use. According to Blackwell, pricing is normally a very vital aspect of any product.T he market price of the twist kettle makes it affordable for the average household, thus providing adding value. The project is extremely competitive and the commercialization process is expected to gain significant market share. This was after intensive market research was conducted investigating consumer attitudes to sustainable products with the intention of knowing what exactly consumers had in mind in regard to a sustainable kettle that could appeal to the wider market rather than just environmentalists. An aspect that Rogers recommended greatly in his written works about innovations. Before venturing into any business, in one's plan, ther e must be a rationale to as why they have decided to venture to that said business. The group sat down and came up with a design that embodied sustainable features but within a conventional kettle form which the content of this report is about. Â  Here is a brief summary of some of the key elements in this Twist Kettle business plan devised by our group. It largely talks about our product which is the kettle and of what importance and benefits it has over what has been on the market. The whole concept of marketing it and the concerned team and not forgetting other closely related aspects like the financing.

Education and Learning Theory Essay Example | Topics and Well Written Essays - 1000 words

Education and Learning Theory - Essay Example The three learning theories discussed include a number of conceptual differences with regard to preparing instructional multimedia design. In terms of explaining mental activities, Behaviourism is associated with the body while Cognitivism is related to the mind. Cognitive notions include schema or knowledge structures in learning processes, which do not find any behavioural equivalent. In Behaviourism, the instructor designs the learning environment. Cognitive approach involves the instructor in structuring problem solving activities with group learning strategies. In case of Constructivism, the instructor focuses on peer interaction through which, learners can develop their knowledge on known concepts. In Behaviourism, the learner remains passive; in Cognitivism, he learns to process, store and retrieve information for future use. The proposed project on Production of a Visual Basic Tutor intends to include the learning theories of Behaviourism, Cognitivism and Constructivism while preparing the instructional multimedia design. A systematic instructional design should include all the three theories that will help analyse learners, make objectives for the course, set the instructional preferences and assess student performance. Student interaction with teachers, course materials, and among themselves is an essential requirement in a learning situation. It is the main objectivity of the instructional design to analyse learners and provide them with required knowledge by creating a problem solving situation.

Genetic Diversity and QoI Fungicide Resistance

Genetic Diversity and QoI Fungicide Resistance Study of genetic diversity and QoI fungicide resistance in frogeye leaf spot (Cercospora sojina) from Tennessee Introduction Frogeye leaf spot (FLS) of soybean (Glycine max Merr.), caused by the fungal pathogen C. sojina Hara, was first identified in Japan in 1915 and South Carolina, the United States in 1924 (Lehman 1928; Phillips 1999). FLS is an important foliar disease of soybean although symptoms can appear on stems, pods, and seeds. There has been no report of the alternative host in other crops or weeds (Mian et al. 2008). Initial symptom appears as small, light brown circular spot which is later surrounded by darkish brown to reddish circle. (Dashiell and Akem 1991). As the leaves are covered with 50% lesions, leaves start to blight wither and finally falls prematurely. On the lower surface of leaves, the central spot of lesions is somewhat grayish because of conidia produced on conidiophores. Conidia are a primary and secondary source of inoculum and are produced in infected leaves, stems, and pods. Warm temperature and frequent rainfall are suitable factors for severe disease, and fully expanded leaves are more resistant with small lesions as compared to younger leaves (Phillips 1999). The United States is the leading producer of soybean in the world. According to the food and agriculture organization (FAO), the US produced 108 million metric tons of soybeans, second only to corn in 2014 (http://faostat3.fao.org/). FLS is an important disease in most of the soybean growing countries in the world and the main factors hindering the yield includes a reduction in photosynthetic area and premature defoliation of leaves (Mian et al. 2008; Wrather et al. 2010). In the US, FLS is significantly present in Southern warm and humid regions (Mian et al. 2008; Yang et al. 2001). Now, C. sojina is also important to Northern states as the disease was reported in Iowa in 1999, Wisconsin in 2000 (Mengistu et al. 2002) and Ohio in 2006 (Cruz and Dorrance 2009). The damage caused by FLS depends on soybean cultivars and locations, and yield loss has been reported from 10% to more than 60% (Dashiell and Akem 1991; Hartwig and Edwards Jr 1990; Laviolette et al. 1970; Mian et al. 1998). FLS is a polycyclic disease and the disease remains active throughout the growing season (Kim et al. 2013; Laviolette et al. 1970). Dispersal of conidia to some distance is favored by the wind and water splashes (Laviolette et al. 1970). Mycelium of C. sojina can overwinter and a report suggests potential survival of the pathogen in the plant debris for two years (Zhang and Bradley 2014). There are several FLS control methods including cultural practices, use of fungicides and genetic resistance. Primarily, genetic resistance is a most effective measure to control FLS. Till now, three resistant genes Rcs (Resistant to C. sojina), have been deployed: Rcs1 (Athow and Probst 1952), Rcs2 (Athow et al. 1962) and Rcs3 (Phillips and Boerma 1982). The Rcs3 gene confers resistant against race 5 and all known races of C. sojina present in the USA. (Mengistu et al. 2012; Phillips and Boerma 1982). Similarly, crop rotation for two years has been suggested to skip viable inoculum and prevent dise ase severity in the field (Grau et al. 2004; Zhang and Bradley 2014). Further, use of pathogen-free seeds and necessary application of fungicides before flowering to early pod stage have been practiced to decrease disease severity (Grau et al. 2004). Meanwhile, because of change in the pathogen, it has been proven that resistant gene can confer resistance for a certain period and there can be selection against QoI fungicides too (Athow and Probst 1952; Athow et al. 1962; Zeng et al. 2015). There has already been a report of field isolates resistant to QoI fungicides in Tennessee (Zhang et al. 2012). Control measures like use of fungicides and planting of resistant cultivars force pathogens to select against selection pressure. Studies of C. sojina using several approaches indicate diversity among isolates. Because of the lack of universally accepted soybean differentials, its hard to characterize and compare C. sojina isolates. Grau et. al. (2004) have reported 12 races of C. sojina in the US, 22 races in Brazil and 14 races in China. A new set of 12 soybean differentials and 11 races have been proposed based on the reaction of isolates collected from the USA, Brazil, and China (Mian et al. 2008). However, the reaction of 50 isolates from Ohio on the same 12 soybean differentials produced 20 different races (Cruz and Dorrance 2009). There has been a handful of research to characterize C. sojina based on molecular markers. One study includes AFLP based assessment of 62 isolates from Brazil, China, Nigeria and the United States, which showed a significant amount of genetic diversity among isolates, although genotypes did not cluster based on origin. (Bradley et al. 2012). Recently, a study of 132 isolates fr om Arkansas with simple sequence repeat (SSR) has shown the chances of sexual reproduction and high genetic diversity in C. sojina (Kim et al. 2013). The main objectives of this study were to access: genetic diversity by developing and using novel SNP markers and distribution of QoI resistant and sensitive isolates from Jackson and Milan, TN. Sample collection, Single-lesion Isolation, and DNA extraction In 2015, soybean leaves exhibiting typical symptoms of infection with FLS were collected from research plots at two locations in Tennessee (Milan and Jackson). In total, 437 isolates, 203 from Jackson and 234 from Milan, were collected from eight fungicides treated and non-treated Maturity group III soybean cultivars (Table 1). Cultivars were planted in 4 rows (30-inch row spacing), 30 ft long plots in a randomized complete block design with four replications. Plots were split, two rows were not treated, and two rows were treated at R3 growth stage (beginning pod) with Quadris Top SB at 8 fl oz/a (Azoxystrobin and Difenoconazole, Syngenta Corp., Basel, Switzerland). A single isolate of C. sojina was obtained from a single lesion from each leaf. Sporulation was induced by incubating leaves in a plastic bag with moist towels at room temperature. Spores were harvested with a flame-sterilized needle using a dissecting microscope and 8-10 spores transferred to RA-V8 agar media (rifampicin 25 ppm, ampicillin 100 ppm, 160 mL unfiltered V8 juice, 3 gm calcium carbonate and 840 mL water). Observations were made daily and contaminated sectors removed. After seven days, single-lesion isolates of C. sojina were transferred to a new V8 agar media. In addition, a set of 40 isolates from 10 different states, collected before 2015, were included in this study (Table 2). Table 1. Soybean cultivars and number of Cercospora sojina isolates recovered from treated and non-treated cultivars. Cultivar ID Cultivars Jackson Milan Total Treated Non-treated Treated Non-treated C1 VAR Armor 37-R33 RR2 17 11 21 4 53 C2 VAR Asgrow AG3832 GENRR2Y 7 15 20 14 56 C3 VAR Becks 393R4 0 0 0 3 3 C4 VAR Croplan R2C 3984 19 13 11 14 57 C5 VAR Mycogen 5N393R2 RR2 g 12 20 17 28 77 C6 VAR Terral REV 39A35 10 15 13 16 54 C7 VAR USG 73P93R 22 6 13 21 62 C8 VAR Warren Seed 3780 R2Y It 14 22 13 26 75 Table 2. Number of Cercospora sojina isolates collected from Jackson (JTN) and Milan (MTN), Tennessee in 2015 and historical isolates from various states in previous years. Location No. of Samples Year JTN 203 2015 MTN 234 2015 AL 5 2006 AR 5 2006 FL 1 2006 GA 4 2006 IA 1 2006 IL 2 2006/09 LA 1 2006 MS 6 2006 SC 2 2006/2009 TN 12 2007 WI 1 2006 Note: JTN (Jackson) and MTN (Milan) collection in 2015 in Tennessee. TN is a historical collection. For DNA extraction, the single-lesion isolates were grown in 24-well deep well plates (Fisher Scientific) with 1 mL RA-V8 liquid broth (same as above, minus the agar) per well. DNA was extracted as described by Lamour and Finley (2006). Briefly, this includes harvesting mycelium from the broth cultures into a 96-well 2 mL deep well plate pre-loaded with 3-5 sterilized 3 mm glass beads. The plates are freeze dried and the dried mycelium powdered using a Mixer-Mill bead beating device (Qiagen). The powdered mycelium was then lysed and a standard glass fiber spin-column DNA extraction completed. The resulting genomic DNA was visualized on a 1% gel and quantified using a Qubit device. SNP marker discovery and targeted-sequencing based genotyping Whole genome sequencing was accomplished for three FLS isolates from a historical collection originally compiled by Dr. Dan Philips, UGA: FLS11 (CS10117) recovered from Milan, Tennessee in 2010, FLS19 (TN10) from the Georgia Experiment Station, and FLS21 (TN85) which was recovered from Mississippi. Genomic DNA was extracted from freeze-dried and powdered mycelium using a standard phenol-chloroform approach and the resulting DNA was submitted to the Beijing Genomics Institute in China for 2100 paired-end sequencing on an Illumina HiSeq2000 device. De novo assembly, read mapping and SNP discovery was accomplished with CLC Genomics Workbench 7 (Qiagen). As there was no public reference genome available at the time, FLS21 was de novo assembled using the default settings in CLC and the resulting contigs used as a reference genome. All open reading frames (ORFs) longer than 300 amino acids were predicted using CLC and annotated onto the FLS21 contigs. The raw reads from FLS11 and FLS19 wer e then mapped to the draft reference (separately), and putative single nucleotide variants (SNVs) identified at sites with at least 20X coverage and an alternate allele frequency greater than 90%. A subset of the SNVs was chosen from the largest contigs for further genotyping using a targeted sequencing approach. Custom Perl scripts were used to extract the flanking sequences for the panel of SNPs and primers were designed using BatchPrimer3 v1.0 (http://probes.pw.usda.gov/batchprimer3/) to amplify targets between 80 and 120bp in length. Primers for 50 SNPs including mitochondrial QoI resistant locus are summarized in Table 3. Primer sequences and genomic DNA were sent to Floodlight Genomics (Knoxville, TN) for processing as part of a non-profit Educational and Research Outreach Program (EROP) that provides targeted-sequencing services at cost for academic researchers. Floodlight Genomics uses an optimized Hi-Plex approach to amplify targets in multiplex PCR reactions and then sequences the resulting sample-specific amplicons on either an Illumina or Ion NGS device. Resulting sample-specific sequences were mapped to the reference contigs and genotypes assigned for loci with at least 6X coverage. QoI resistant locus genotyping A single nucleotide polymorphism (G/C) in the Cytochrome b gene of the C. sojina mitochondrial genome has been shown to confer resistance to QoI fungicides. A custom TaqMan SNP genotyping assay will be designed using the online design tools from Applied Biosystems (Thermo Scientific) and include the forward primer GGGTTATGTTTTACCTTACGGACAAATG and reverse primer GTCCTACTCATGGTATTGCACTCA and two probes to discriminate resistant and sensitive isolates: ACTGTGGCAGCTCATAA with VIC for the C resistance allele and ACTGTGGCACCTCATAA with FAM for the G sensitive allele (Zeng et al. 2015). Quantitative PCR (qPCR) will be accomplished based on manufacturer instruction using the QuantStudio 6 Flex Real-time PCR System (Thermo Fisher Scientific Inc.). Mating types determination A previously described multiplex PCR assay will be used to assign mating type (MAT1-1-1 or MAT1-2) to a subset of the isolates that had unique multi-locus SNP genotypes (Kim et al. 2013). The MAT1-1-1 locus will be amplified with CsMat1f (5 TGAGGACATGGCCACCCAAATA) and CsMat1r (5 AAGAGCCCTGTCAAGTGTCAGT) and the Mat1-2 locus will be amplified with CsMat2f (5 TGTTGTAGAGCTCGTTGTTCGCA) and CsMat2r (5 TCAGACCTTATGAGCTTGAAAGTGCT) primers (Kim et al. 2013). The assay will be included with the ITS5 (5 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 TCCTCCGCTTATTGATATGC ) primers as an internal control to amplify the internal transcribed spacer (ITS) region (White et al. 1990). The resulting PCR products will be visualized under UV light on 2% agarose gel stained with GelRed (Phenix Research Products) and scored based on fragment size of MAT1-1-1 (405 bp) and Mat1-2 (358 bp). Data Analysis SNP loci for each sample will be combined to form a multi-locus SNP genotypes and samples with identical genotype (clonal lineages) will be clone corrected. To assess population structure among the two locations (and in relation to the historical isolates), Bayesian clustering will be accomplished using Structure 2.3.4 (Pritchard et al. 2000). Structure Harvester (Earl 2012) will be used to find the most probable value of K from the results obtained from Structure analysis. Principle coordinate analysis, AMOVA, Nei pairwise genetic distance, Nei pairwise genetic identity and genetic indices will be analyzed with GENALEX (Peakall and Smouse 2006). Phylogenetic clustering of the unique genotypes will be accomplished using Mega 6.06 (Tamura et al. 2013). Minimum spanning networks (Bandelt et al. 1999) will be constructed with PopART (http://popart.otago.ac.nz/). Expected Results Novel SNP markers will be developed and assayed in C. sojina isolates. Population study will help to determine if the isolates from two locations are sub-grouped. The genetic study will also accesses genetic diversity present within and among populations. Molecular identification of mutated cytochrome b site will help to determine the distribution of resistant isolates and contribute to compare resistant isolates in fields between two different time periods. Study of two different mating types in population will help to predict sexual reproduction. References Athow K and Probst AH. 1952. The inheritance of resistance to frog-eye leaf spot of Soybeans. Phytopathology 42(12):660-662 pp. Athow KL, Probst AH, Kurtzman CP and Laviolette FA. 1962. A newly identified physiological race of Cercospora sojina on soybean. Phytopathology 52(7):712-714 pp. Bandelt H-J, Forster P and RÃ ¶hl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular biology and evolution 16(1):37-48. Bradley C, Wood A, Zhang G, Murray J, Phillips D and Ming R. 2012. Genetic diversity of Cercospora sojina revealed by amplified fragment length polymorphism markers. Canadian Journal of Plant Pathology 34(3):410-416. Cruz C and Dorrance A. 2009. Characterization and survival of Cercospora sojina in Ohio. Plant Health Progress doi 10. Dashiell K and Akem C. 1991. Yield losses in soybeans from frogeye leaf spot caused by Cercospora sojina. Crop Protection 10(6):465-468. Earl DA. 2012. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources 4(2):359-361. Grau CR, Dorrance AE, Bond J and Russin JS. 2004. Fungal diseases. Soybeans: Improvement, production, and uses(soybeansimprove):679-763. Hartwig E and Edwards Jr C. 1990. The uniform soybean tests, southern region, 1989. USDA Mimeographed Rep. US Gov. Print. Office, Washington, DC. Kim H, Newell AD, Cota-Sieckmeyer RG, Rupe JC, Fakhoury AM and Bluhm BH. 2013. Mating-type distribution and genetic diversity of Cercospora sojina populations on soybean from Arkansas: Evidence for potential sexual reproduction. Phytopathology 103(10):1045-1051. Laviolette F, Athow K, Probst A, Wilcox J and Abney T. 1970. Effect of bacterial pustule and frogeye leafspot on yield of Clark soybean. Crop science 10(4):418-419. Lehman S. 1928. Frog-eye leaf spot of Soy Bean caused by Cerco-spora diazu Miara. Journal of Agricultural Research 36(9):811-833. Mengistu A, Bond J, Mian R, Nelson R, Shannon G and Wrather A. 2012. Resistance to Frogeye Leaf Spot in selected soybean accessions in MG I through MG VI. Plant Health Progress 10. Mengistu A, Kurtzweil NC and Grau CR. 2002. First report of Frogeye Leaf Spot (Cercospora sojina) in Wisconsin. Plant Disease 86(11):1272-1272. Mian M, Boerma H, Phillips D, Kenty M, Shannon G, Shipe E, Blount AS and Weaver D. 1998. Performance of frogeye leaf spot-resistant and-susceptible near-isolines of soybean. Plant disease 82(9):1017-1021. Mian M, Missaoui A, Walker D, Phillips D and Boerma H. 2008. Frogeye Leaf Spot of Soybean: A review and proposed race designations for isolates of Hara. Crop science 48(1):14-24. Peakall R and Smouse PE. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular ecology notes 6(1):288-295. Phillips D. 1999. Frogeye leaf spot. Compendium of soybean diseases, 4th ed. American Phytopathological Society Press, St. Paul, MN:20-21. Phillips D and Boerma H. 1982. Two genes for resistance to race 5 of Cercospora sojina in soybeans. Phytopathology 72(7):764-766. Pritchard JK, Stephens M and Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155(2):945-959. Tamura K, Stecher G, Peterson D, Filipski A and Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution:mst197. White TJ, Bruns T, Lee S and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18(1):315-322. Wrather A, Shannon G, Balardin R, Carregal L, Escobar R, Gupta G, Ma Z, Morel W, Ploper D and Tenuta A. 2010. Effect of diseases on soybean yield in the top eight producing countries in 2006. Plant Health Progress doi 10:2008-2013. Yang X, Uphoff M and Sanogo S. 2001. Outbreaks of soybean frogeye leaf spot in Iowa. Plant Disease 85(4):443-443. Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Sierotzki H, Ming R, Bluhm B, Bond J and Fakhoury A. 2015. Characterization of quinone outside inhibitor fungicide resistance in Cercospora sojina and development of diagnostic tools for its identification. Plant Disease 99(4):544-550. Zhang G and Bradley CA. 2014. Survival of Cercospora sojina on soybean leaf debris in Illinois. Plant Health Prog 10. Zhang G, Newman M and Bradley C. 2012. First report of the soybean frogeye leaf spot fungus (Cercospora sojina) resistant to quinone outside inhibitor fungicides in North America. Plant Disease 96(5):767-767.

Theme of Good vs. Evil in “Sweat” Essay -- Literary Analysis

The main character in Zora Neale Hurston’s â€Å"Sweat† is a black woman who resides in the South that clutches on to her belief in God to help her get through the suffering that she endures from her abusive and adulterous husband, Sykes. â€Å"Sweat† is full of religious symbolism that demonstrates that Hurston was using the theme of good vs. evil in the short story. In the very beginning of â€Å"Sweat† one can see that Delia possesses a very strong work ethic, by the way that she is working vigorously to wash the clothes for the white people that she worked for to put food on the table and a roof over her and Sykes’ head. The white clothing that Delia washes in the story represents her character. White signifies her virtuousness and wholesome spirit. Delia has a docile personality and a prevailing belief in God. Delia’s body may be physically broken from all the years of tough labor and mistreatment from Sykes, however her spirit remains unbroken. Delia is a church going woman that is inspired by her trust in God. She has confidence that God will steer her the right way and shield her from Sykes cruel physical and emotional abuse. Another reference to Delia’s goodness can additionally be located in these lines of "Sweat,† "Delia's work-worn knees crawled over the earth in Gethsemane and up the rocks of Calvary many, many times during these months" (445). According to Raymond Brown, who wrote, A Crucified Christ in Holy Week: Essays on the Four Gospel Passion Narratives, the garden of Gethsemane is the location where Jesus took his followers to pray. He advised some of them to observe and several of them to pray, however they fell asleep. Judas betrayed Jesus and escorted the Romans to him at Gethsemane prior to him being executed (49).... ...btains wisdom. Delia's goodness and her faith in God in the end, prevails over Sykes’ powerful muscle and violent manner. Bibliography Brown, Raymond. A Crucified Christ in Holy Week: Essays on the Four Gospel Passion Narratives. Collegeville, Minnesota: The Liturgical Press, 1986. Hurston, Zora Neale. â€Å"Sweat.† The Custom Library of American Literature. John Bryant. Boston, Massachusetts: Pearson Custom Publishing, 2008. 440-445. Jones, Sharon. Rereading the Harlem Renaissance: Race, Class, and Gender in the Fiction of Jessie Fauset, Zora Neale Hurston, and Dorothy West. Westport, Connecticut: Greenwood Press, 2002. Masson, Davis. Essays Biographical and Critical: Chiefly on English Poets. La Vergne, Tennessee: Lightning Source, Inc., 2007. Mà ©nez, Andre’. The Subtle Beast: Snakes, from Myth to Medicine. New York, New York: CRC Press, 2003. Theme of Good vs. Evil in â€Å"Sweat† Essay -- Literary Analysis The main character in Zora Neale Hurston’s â€Å"Sweat† is a black woman who resides in the South that clutches on to her belief in God to help her get through the suffering that she endures from her abusive and adulterous husband, Sykes. â€Å"Sweat† is full of religious symbolism that demonstrates that Hurston was using the theme of good vs. evil in the short story. In the very beginning of â€Å"Sweat† one can see that Delia possesses a very strong work ethic, by the way that she is working vigorously to wash the clothes for the white people that she worked for to put food on the table and a roof over her and Sykes’ head. The white clothing that Delia washes in the story represents her character. White signifies her virtuousness and wholesome spirit. Delia has a docile personality and a prevailing belief in God. Delia’s body may be physically broken from all the years of tough labor and mistreatment from Sykes, however her spirit remains unbroken. Delia is a church going woman that is inspired by her trust in God. She has confidence that God will steer her the right way and shield her from Sykes cruel physical and emotional abuse. Another reference to Delia’s goodness can additionally be located in these lines of "Sweat,† "Delia's work-worn knees crawled over the earth in Gethsemane and up the rocks of Calvary many, many times during these months" (445). According to Raymond Brown, who wrote, A Crucified Christ in Holy Week: Essays on the Four Gospel Passion Narratives, the garden of Gethsemane is the location where Jesus took his followers to pray. He advised some of them to observe and several of them to pray, however they fell asleep. Judas betrayed Jesus and escorted the Romans to him at Gethsemane prior to him being executed (49).... ...btains wisdom. Delia's goodness and her faith in God in the end, prevails over Sykes’ powerful muscle and violent manner. Bibliography Brown, Raymond. A Crucified Christ in Holy Week: Essays on the Four Gospel Passion Narratives. Collegeville, Minnesota: The Liturgical Press, 1986. Hurston, Zora Neale. â€Å"Sweat.† The Custom Library of American Literature. John Bryant. Boston, Massachusetts: Pearson Custom Publishing, 2008. 440-445. Jones, Sharon. Rereading the Harlem Renaissance: Race, Class, and Gender in the Fiction of Jessie Fauset, Zora Neale Hurston, and Dorothy West. Westport, Connecticut: Greenwood Press, 2002. Masson, Davis. Essays Biographical and Critical: Chiefly on English Poets. La Vergne, Tennessee: Lightning Source, Inc., 2007. Mà ©nez, Andre’. The Subtle Beast: Snakes, from Myth to Medicine. New York, New York: CRC Press, 2003.

It205 – Hardware Replacement Project

Hardware Replacement Project IT/205 – Management of Information systems June 24, 2012 Cristina Oliver Hardware Replacement Project The IT department is implementing a new CRM solution in its corporate offices. The hardware currently in use is out of date and will not support the CRM application. The hardware must be replaced prior to deployment. Resource: Ch. 11 of Essentials of Management Information Systems Write a 1,050- to 1,750-word paper that addresses the following: How do the five major variables of project management—scope, time, cost, quality, and risk—relate to this scenario?What considerations must be applied when selecting projects that deliver the best business value? What factors that influence project risk? What strategies would you recommend for minimizing this project’s risks? * The Information Technology department is implementing a new CRM (Customer Relationship Management) solution in its corporate offices but what we found is that the current hardware is out-of-data and will not support the new CRM application, so to implement the new CRM solution we must upgrade all the hardware prior to deployment of the CRM application.The assessment of scope, time, cost, quality and risk are the five variables needed to consider when planning out this project of the hardware replacement for the CRM application. â€Å"Project management refers to the application of knowledge, skills, tools, and techniques to achieve specific targets within specific budgets† (Laudon & Laudon, 2011, P. 397). The project managers’ position is to align the project to meet the necessary target in which they must estimate resources required for the work (materials and people), plan the work, assign and direct the work, report progress, analyze the results, acquire materials, and assesses the risk.In implementing the CRM project we see that the project scope is to have all hardware replaced. Hardware that would be replaced are desktops , servers and possibly handheld devices. Prior to installation of hardware to the corporate offices there will be installation of the software which includes operating systems, standard company applications and the new CRM application, testing of the applications and hardware in the test environment prior to testing on the production network and just before replace of the hardware to the offices there will be education training and then a small department rollout to verify and finalize any risks.We need to figure a realistic time to achieve our target on the CRM project as time. What will be needed is to break down each component into separate tasks and activities so each team has time to accomplish their tasks. Remember that each task given is dependent for the next task to succeed. This give a schedule of when the project may be completed. â€Å"Costs are based on the time to complete a project multiplied by the daily cost of human resources required to complete the project† (Laudon & Laudon, 2011, P. 399). Costs also include the hardware, software and real estate of where someone sits when doing the work.The project manager is responsible for developing the budget as well as monitoring the expenses of the ongoing project attempting not to go over their projected budget. Quality is the indication of how well the project is going and also how well the end result satisfies the objects requested by management. Quality defines the workmanship, accuracy and the timelines of the information produced by the new system being implemented. Quality grants a more positive outcome within the project team as well as management. Risk are something that happens with all projects as they are potential problems that threaten the success of a project.The problems that could arise can prevent a project from meeting it’s timelines by increasing time and costs, lowering the quality of the output or possibly preventing the project altogether. When given the project t imeline it is normally given some of the risks involved with each tasks and within the project there is the attempt to give buffer time should those risks appear. Considerations that must be applied when selecting projects that deliver the best business value are benefits and costs. In the long or possibly short are the benefits that can regain costs and possibly or will increase financial gains for the business.The company needs to realize the CRM application; if it will indeed benefit from this application and that the application covers all aspects of what the required objectives. Obviously if the company purchases the CRM application and doesn’t meet the requirements then the project will not reap the benefits or costs. Other considerations are training and maintenance of the hardware, software and application. Without training of the application how would one know how to use it to its full potential? Training is planned and designed for the various users and departments. With the CRM application each department will have their specific requirements as to what they will use it for and what they can and cannot access. The IT group will be trained on how to support the application and how to maintain and upgrade when needed. This leads into maintenance which is never cost effective but normally mandatory for reasons of fixing application bugs or hardware upgrades and even operating system updates. Factors or levels that may influence project risk are size of the project, structure of the project and the level of technical expertise (SME – Subject Matter Experts) of the IT staff and project team.Other considerations are consultants if the IT staff is does not have the technical expertise although proper training or shadowing will need to be involved of the consultant to an IT staff. Other factors such as not clear or straightforward requirements or even new technology that the project team does not know the technology can influence the project ri sk. Even user acceptance of the application is a major factor as some don’t like change or fear new products. There are many factors that can influence the risk of the project.Strategies that I would use to minimize the project risk would be to recruit people whom are SME with products that we are looking to implement, recruit project managers that are expertise in information technology and use the correct tools to manage the project and the deliverables. Implement the proper changes management in advance to have the changes documented in case need to revert back and make sure everything is tested in a test environment prior to placing into a production environment. Train the staff and end-users to make sure everyone is comfortable with the new system.People fear change and to have an in-depth training program will allow the end-users more comfort with the product and in themselves. The number strategy I would use to minimize project risk is communication. Making sure that e veryone is on the same page with the deadlines and deliverables. Understanding the timeframe and what need to be done to accomplish the project. The project team needs to see the possible risks that are involved and how they could avoid these risks and make sure they are all documented.I believe that the best practices for managing this project are hiring project managers that have managed successful project in the IT field and have them communicate with the leads of the IT teams to set realistic timeframes to measure the progress of the tasks to overall meet the deliverables and the end date of the project. Communication to the company executives to make sure they understand the timeframe of the project and the implantation of each task and what dates they will be accomplished as well as verifying what are the requirements of management for the project.With regards to all this the project manager will put a project plan with timeframes and risks to hand out to all the project team and management so everyone understands what is involved and what deadlines each team needs to make. Make such dates will show quality to management and the company allowing a much smoother transition to the new CRM application and hardware. Reference Laudon, K. P. , & Laudon, J. P. (2011). Essentials of MIS (9th ed. ). Upper Saddle River, NJ: Prentice Hall.

An analysis of chapter five’s significance to the novel as a whole including some of the novel’s broader issues & concerns

This novel is about a boy called Alem. The book concentrates on the issues of immigration and those closely affected by it, the main character in the book is a young boy called Alem who has fled his country of origin Ethiopia because of growing tensions between Ethiopia and its neighbouring country Eritrea. Alem's mother is from Eritrea and his father is from Ethiopia and those two countries are in war that's why his family are not accepted in both countries because of Alem's mixed heritage and his families mixed marriage, they are firstly driven from their home in Ethiopia by the local police and then they face prejudice in Eritrea. His dad felt it's insecure for Alem to stay in Eritrea while the war going on between those two countries. Alem's father took him on a holiday to England but Alem is unaware of his father's plan, which is to leave Alem in England until this was is over. In their arrival in England they stay in a hotel after few days of sight seeing Alem's father leaves Alem in the hotel and go back to Eritrea. Before chapter five Alem meets Pamela and Mariam who works in the refugee council. They helped Alem to apply for asylum seekers to stay in England. Until the home office processing the asylum application, they found a children home for Alem to stay. Chapter five is one of the significant chapter in the whole novel because its shows the development of novel it builds up the tension so the readers can get excited to find out what is going to be the next step of the novel. In this chapter most of the characters are introduced. Chapter 5 begins with Alem arriving at the children's home and a description of what the place looks like and how it makes Alem feel. He is firstly introduced to a worker at the children's home named Sarah Cohen who shows him around the place informs him of the rules and regulation of the place. During the exploration of the home Alem meets another worker named Tom Whittaker and a man named Dave he notices a boy sitting by himself and is informed that this boys name is Mustafa. While he is still being showed around the place he meets his soon to be enemy Sweeney for the first time in the smoker's room. Sweeny later demands Alem to get some biscuits. When Alem refused to get biscuits for Sweeney they start arguing, Tom hears the argument and Alem explains to Tom the whole situation and then Tom makes Sweeny apologise for anti social behaviour. Alem meets his room partner called Stanley Burton who is orphan and depress in his arrival Stanley tells Alem his own story of why he's at the children's home. All the characters behaviors in the children's house show how unorganized asylum systems. However there are some people who are emotionally attach in their past for e.g. Stanley Burton is mentally ill but no one in the children's house take him seriously about the effects his having on his mind. After chapter five the story largely concentrates on Alem's struggles to familiarise him to this foreign land. He goes to the refugee camp. He gets bullied, but where he also manages to make some friends. Alem had a fight with Sweeney but makes friends with Mustafa and decides to run away from the children's home. He gets lots of support from the Refugee Council, who fined a better place for him to stay. His been fostered by a family. It was difficult for him to adjust in another house with new people but he manages to stay with them. He starts going to a school and again he face racism and bullies in school. Meanwhile the trouble in Ethiopia and Eritrea is gathering rapidity. His mums died in the war and his dad comes back to England to live with his son. Alem's get really happy and excited to have one of his family members around him. The government refused to give them permission to stay in England. After couple of weeks his father also passed way in a car accident. In my opinion Benjamin Zephaniah wrote this story in order to educate people of the growing problems of the way refuges are treated in this country. He is trying to give people an understanding of the way a young refuge might look at our country and what they might think of our customs. He is also showing that underneath skin colour, culture and customs we all think and are alike. Benjamin Zephaniah intentions and objective are to demonstrate the anguish and struggles that many asylum seekers have to go through in England. The author took ideas from many writers and books, which are related to refugees to make this book unique and special to the readers. He attempt to influence the readers with a combination of layout, emotions are raised, and guilt is created to feel sorry for Alem and it shows how to be strong when people have to deal with problematic situation that they face while they are living in a children's home. Chapter 5 is very important to the story because it shows Alem and no mater where he is aggression follows him. I felt this chapter have really emotional attach to it. Many characters are introduced in this chapter because some of the characters encouraged Alem to become a stronger person and some of the characters are shown to bully him so he can show his strength to stand up for himself. In this chapter it showed the position of each character. He learns to make a judgment on other characters. This chapter is very important because it shows how the system works and it's the beginning of all the struggles for Alem for e.g. living independently, getting bullied etc. This chapter sounds different than other chapter of the novel because its sound more dramatic, helpless, angry and showing his strength. The other sound was informative, balance and controlled. He shows responsibility, development of his knowledge by dealing with problematic situation and trying to adjust in a new environment. This chapter seems so realistic. It is a simple chapter to read because it has a good solid plot and structure of the book makes it easier to understand roles of each character. It shows how the main character of the novel starts living independently. This chapter expose Alem's character by showing amazing strength to keep standing in the toughest time while he was at the children's home for e.g. one of the boy wants him to get some biscuits but Alem replied ‘I don't want any biscuits. If you want biscuits you get them yourself'. It shows that he is not scared of anyone, he is a straightforward person who wants to stay out of trouble but he is not scared to tell the truth. The main character is Alem this is because he is someone who can be trust and empathize in the whole novel. He is the only character in the whole novel. The whole novel was written to explore this character. Alem is well presented to show his strength and weaknesses. This is a unique character because he's the refugee and all the other characters are the supporting character to help Alem to get justice. Alem is the central character in the book because the author believed that the easiest way to tell the story of a refugee would be by telling it through the eyes of Alem, this would help the audience to imagine themselves in the place of a refugee. I think that chapter 5 is a real turning point in the story because it reveals more of Alem's character then other chapters so it makes it easier for the audience to formularise themselves with Alem's character. It is an excellent topic about which to write because there are rarely books about this particular topic and I believe people should be informed. The story line is thoughtful for me and it proved to be a stimulating and moving experience. The message behind this novel was to inform people how refugees used to get treated in the past. Benjamin Zephaniah understood the character this is because he did endure racism in his childhood when he arrived from Africa. He can relate this book to his own life.